"""
DNA Sequence Search System
Searches for gene sequences in complementary DNA strands stored in dna sequence 6GB
simulate DB with connection pooling (max 10 connections per database)
"""
from __future__ import annotations
import argparse
import os
import time
from typing import Iterable, List, Optional
def _human_readable(n: int) -> str:
for unit in ('B', 'KB', 'MB', 'GB', 'TB'):
if n < 1024:
return f"{n:.2f}{unit}"
n /= 1024
return f"{n:.2f}PB"
def reverse_complement(seq: bytes) -> bytes:
"""Return the reverse-complement of a DNA sequence bytes (A,T,G,C)."""
table = bytes.maketrans(b'ATGCatgc', b'TACGtacg')
return seq.translate(table)[::-1]
def normalize_pattern(p: str) -> bytes:
return p.strip().upper().encode('ascii')
def stream_search(file_path: str, pattern: bytes, chunk_size: int = 1 << 20) -> Iterable[int]:
"""Yield file offsets where `pattern` occurs in `file_path` using streaming reads.
This is memory efficient and handles matches that span chunk boundaries by
carrying an overlap of len(pattern)-1 bytes between chunks.
"""
if not pattern:
return
patlen = len(pattern)
overlap = patlen - 1
with open(file_path, 'rb') as f:
pos = 0
tail = b''
while True:
chunk = f.read(chunk_size)
if not chunk:
break
buf = tail + chunk
start = 0
while True:
idx = buf.find(pattern, start)
if idx == -1:
break
yield pos - len(tail) + idx
start = idx + 1
# prepare tail for next chunk
if overlap > 0:
tail = buf[-overlap:]
else:
tail = b''
pos += len(chunk)
def main(argv: Optional[List[str]] = None) -> int:
parser = argparse.ArgumentParser(description='Streaming DNA sequence search')
parser.add_argument('--file', '-f', help='Path to DNA sequence file', required=False)
parser.add_argument('--pattern', '-p', help='DNA pattern to search for (e.g. ATG)', required=False)
parser.add_argument('--pattern-file', help='File containing pattern (first line used)')
parser.add_argument('--reverse', '-r', action='store_true', help='Also search reverse-complement')
parser.add_argument('--chunk-size', type=int, default=1 << 20, help='Read chunk size in bytes')
parser.add_argument('--max-results', type=int, default=0, help='Stop after this many results (0 = unlimited)')
parser.add_argument('--example', action='store_true', help='Create a tiny example file and run a sample search')
args = parser.parse_args(argv)
if args.example:
sample = b'AAATGCCCATGTTTATGCGTATG'
sample_path = os.path.join(os.getcwd(), 'sample_dna.txt')
with open(sample_path, 'wb') as f:
f.write(sample)
size = os.path.getsize(sample_path)
print(f'Wrote example file: {sample_path} (size: {_human_readable(size)})')
args.file = sample_path
if not args.pattern:
args.pattern = 'ATG'
if not args.file:
parser.error('--file is required (or use --example)')
if args.pattern_file:
with open(args.pattern_file, 'r', encoding='utf-8') as pf:
args.pattern = pf.readline().strip()
if not args.pattern:
parser.error('--pattern is required (or use --pattern-file)')
pattern = normalize_pattern(args.pattern)
if any(c not in b'ATGC' for c in pattern):
print('Warning: pattern contains non-ATGC characters; results may be unexpected')
matches_found = 0
file_size = os.path.getsize(args.file) if os.path.exists(args.file) else 0
print(f"Searching {args.file} for pattern {pattern.decode()} (chunk={args.chunk_size}, size={_human_readable(file_size)})")
start_time = time.time()
for off in stream_search(args.file, pattern, chunk_size=args.chunk_size):
matches_found += 1
if args.max_results and matches_found >= args.max_results:
break
if args.reverse:
rc = reverse_complement(pattern)
print(f"Searching reverse-complement: {rc.decode()}")
for off in stream_search(args.file, rc, chunk_size=args.chunk_size):
matches_found += 1
if args.max_results and matches_found >= args.max_results:
break
duration = time.time() - start_time
if duration > 0:
rate = matches_found / duration
print(f"Search complete: {matches_found} matches in {duration:.2f}s ({rate:.2f} matches/s)")
else:
print(f"Search complete: {matches_found} matches (duration too short to measure)")
return 0
if __name__ == '__main__':
raise SystemExit(main())
dna-sequencing-match
Experiment · PY